Corrigendum to “GoldCLIP: Gel-omitted Ligation-dependent CLIP” [Genomics Proteomics Bioinformatics 16 (2) (2018) 136–143] (S1672022918300421) (10.1016/j.gpb.2018.04.003))

The authors regret there was a typo for a critical nucleotide in the sequence of the RNA adapter listed in the subsection “GoldCLIP-seq library preparation” of the main text and the 3′ RNA linker listed as a primer in the associated File S1. The RNA adapter/linker sequence “/5′P/AGGTCGGAAGAGCGGTTCAG/3′ddC/” should be corrected to “/5′P/AGATCGGAAGAGCGGTTCAG/3′ddC/”. The correct content in this subsection is shown below. The authors would like to apologize for any inconvenience caused. GoldCLIP-seq library preparation:In a typical GoldCLIP experiment, ∼1 × 10⁷ HEK 293T cells expressing the Halo-PTB fusion protein were crosslinked using UVP crosslinker at either UVC (254 nm, 400 mJ/cm²) or UVA (365 nm, 400 mJ/cm², pre-incubated for 16 h with media containing 100 μM 4-thiouridine). Crosslinked cells were then scraped off the plates and mixed with ∼5 × 10⁵ of Drosophila S2 cells expressing a Halo-CG7544 fusion protein (serving as an internal normalizing control), dounced with type B pestle in lysis buffer (see above) and digested using micrococcal nuclease (1:1000; catalog No. M0247S; New England Biolabs) for 3 min at 37 °C. Magne® HaloTag® Beads (catalog No. G7281; Promega) were incubated with the lysates with rotation at 4 °C for about 10–16 h. Beads associated with Halo-PTB complexes were first washed with PBST (PBS + 0.1% Triton X-100), dephosphorylated with calf intestinal phosphatase (catalog No. M0290S; New England Biolabs) at 37 °C for 30 min. Then the beads were washed with Trizol LS reagent and equilibrated with 8 M urea. The beads were then washed five times with PNK buffer containing 50 mM Tris–HCl (pH 8.0), 10 mM MgCl₂, and 1% Triton X-100. The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGATCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight. Then, further denaturing washes using the buffers containing either 8 M guanidine, 8 M urea or 10% SDS were applied to the beads to completely remove non-covalent contaminants. Finally, PTB–RNA complexes were cleaved off the beads by TEV protease and digested with protease K (catalog No. P8102S; New England Biolabs) at 37 °C for 30 min. The RNA–peptide adducts were cloned following the iCLIP library cloning protocol [11]. The detailed protocol for GoldCLIP-seq is provided in File S1.